custom synthesized dna fragments Search Results


90
GenScript corporation designed dna fragments
Designed Dna Fragments, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/designed dna fragments/product/GenScript corporation
Average 90 stars, based on 1 article reviews
designed dna fragments - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation synthesized dna fragment containing a hepatitis d virus ribozyme (hdvr) sequence
Synthesized Dna Fragment Containing A Hepatitis D Virus Ribozyme (Hdvr) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/synthesized dna fragment containing a hepatitis d virus ribozyme (hdvr) sequence/product/GenScript corporation
Average 90 stars, based on 1 article reviews
synthesized dna fragment containing a hepatitis d virus ribozyme (hdvr) sequence - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Arbor Biosciences custom biotinylated dna fragments mybaits
Custom Biotinylated Dna Fragments Mybaits, supplied by Arbor Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/custom biotinylated dna fragments mybaits/product/Arbor Biosciences
Average 90 stars, based on 1 article reviews
custom biotinylated dna fragments mybaits - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Bioneer Corporation 96-mer custom-synthesized dna capture probe
96 Mer Custom Synthesized Dna Capture Probe, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/96-mer custom-synthesized dna capture probe/product/Bioneer Corporation
Average 90 stars, based on 1 article reviews
96-mer custom-synthesized dna capture probe - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation dna fragment coding for ispe of p. falciparum
Dna Fragment Coding For Ispe Of P. Falciparum, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna fragment coding for ispe of p. falciparum/product/GenScript corporation
Average 90 stars, based on 1 article reviews
dna fragment coding for ispe of p. falciparum - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Genotech Corp dna fragment synthesized from
Dna Fragment Synthesized From, supplied by Genotech Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna fragment synthesized from/product/Genotech Corp
Average 90 stars, based on 1 article reviews
dna fragment synthesized from - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation dna fragment containing the comt2 gene
Dna Fragment Containing The Comt2 Gene, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna fragment containing the comt2 gene/product/GenScript corporation
Average 90 stars, based on 1 article reviews
dna fragment containing the comt2 gene - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation swai-aflii synthesized dna fragments
Swai Aflii Synthesized Dna Fragments, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/swai-aflii synthesized dna fragments/product/GenScript corporation
Average 90 stars, based on 1 article reviews
swai-aflii synthesized dna fragments - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Gene Design Inc custom synthesized 31-mer ss oligonucleotides dna
Custom Synthesized 31 Mer Ss Oligonucleotides Dna, supplied by Gene Design Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/custom synthesized 31-mer ss oligonucleotides dna/product/Gene Design Inc
Average 90 stars, based on 1 article reviews
custom synthesized 31-mer ss oligonucleotides dna - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Metabion International AG synthesized dna fragment 5’-cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag-3
Synthesized Dna Fragment 5’ Cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag 3, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/synthesized dna fragment 5’-cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag-3/product/Metabion International AG
Average 90 stars, based on 1 article reviews
synthesized dna fragment 5’-cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag-3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Oxford Nanopore custom bead purification protocol 'spri size selection protocol for >1.5–2 kb dna fragments
Custom Bead Purification Protocol 'spri Size Selection Protocol For >1.5–2 Kb Dna Fragments, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/custom bead purification protocol 'spri size selection protocol for >1.5–2 kb dna fragments/product/Oxford Nanopore
Average 90 stars, based on 1 article reviews
custom bead purification protocol 'spri size selection protocol for >1.5–2 kb dna fragments - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Boehringer Mannheim 1.6-kb polymerase chain reaction–synthesized fragment of rat cholesterol 7a-hydroxylase complementary dna (cdna)
1.6 Kb Polymerase Chain Reaction–Synthesized Fragment Of Rat Cholesterol 7a Hydroxylase Complementary Dna (Cdna), supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1.6-kb polymerase chain reaction–synthesized fragment of rat cholesterol 7a-hydroxylase complementary dna (cdna)/product/Boehringer Mannheim
Average 90 stars, based on 1 article reviews
1.6-kb polymerase chain reaction–synthesized fragment of rat cholesterol 7a-hydroxylase complementary dna (cdna) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results