90
|
GenScript corporation
designed dna fragments Designed Dna Fragments, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/designed dna fragments/product/GenScript corporation Average 90 stars, based on 1 article reviews
designed dna fragments - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
synthesized dna fragment containing a hepatitis d virus ribozyme (hdvr) sequence Synthesized Dna Fragment Containing A Hepatitis D Virus Ribozyme (Hdvr) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthesized dna fragment containing a hepatitis d virus ribozyme (hdvr) sequence/product/GenScript corporation Average 90 stars, based on 1 article reviews
synthesized dna fragment containing a hepatitis d virus ribozyme (hdvr) sequence - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Arbor Biosciences
custom biotinylated dna fragments mybaits Custom Biotinylated Dna Fragments Mybaits, supplied by Arbor Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/custom biotinylated dna fragments mybaits/product/Arbor Biosciences Average 90 stars, based on 1 article reviews
custom biotinylated dna fragments mybaits - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Bioneer Corporation
96-mer custom-synthesized dna capture probe 96 Mer Custom Synthesized Dna Capture Probe, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/96-mer custom-synthesized dna capture probe/product/Bioneer Corporation Average 90 stars, based on 1 article reviews
96-mer custom-synthesized dna capture probe - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
dna fragment coding for ispe of p. falciparum Dna Fragment Coding For Ispe Of P. Falciparum, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dna fragment coding for ispe of p. falciparum/product/GenScript corporation Average 90 stars, based on 1 article reviews
dna fragment coding for ispe of p. falciparum - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Genotech Corp
dna fragment synthesized from Dna Fragment Synthesized From, supplied by Genotech Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dna fragment synthesized from/product/Genotech Corp Average 90 stars, based on 1 article reviews
dna fragment synthesized from - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
dna fragment containing the comt2 gene Dna Fragment Containing The Comt2 Gene, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dna fragment containing the comt2 gene/product/GenScript corporation Average 90 stars, based on 1 article reviews
dna fragment containing the comt2 gene - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
swai-aflii synthesized dna fragments Swai Aflii Synthesized Dna Fragments, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/swai-aflii synthesized dna fragments/product/GenScript corporation Average 90 stars, based on 1 article reviews
swai-aflii synthesized dna fragments - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Gene Design Inc
custom synthesized 31-mer ss oligonucleotides dna Custom Synthesized 31 Mer Ss Oligonucleotides Dna, supplied by Gene Design Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/custom synthesized 31-mer ss oligonucleotides dna/product/Gene Design Inc Average 90 stars, based on 1 article reviews
custom synthesized 31-mer ss oligonucleotides dna - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
synthesized dna fragment 5’-cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag-3 Synthesized Dna Fragment 5’ Cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag 3, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthesized dna fragment 5’-cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag-3/product/Metabion International AG Average 90 stars, based on 1 article reviews
synthesized dna fragment 5’-cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag-3 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Oxford Nanopore
custom bead purification protocol 'spri size selection protocol for >1.5–2 kb dna fragments Custom Bead Purification Protocol 'spri Size Selection Protocol For >1.5–2 Kb Dna Fragments, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/custom bead purification protocol 'spri size selection protocol for >1.5–2 kb dna fragments/product/Oxford Nanopore Average 90 stars, based on 1 article reviews
custom bead purification protocol 'spri size selection protocol for >1.5–2 kb dna fragments - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Boehringer Mannheim
1.6-kb polymerase chain reaction–synthesized fragment of rat cholesterol 7a-hydroxylase complementary dna (cdna) 1.6 Kb Polymerase Chain Reaction–Synthesized Fragment Of Rat Cholesterol 7a Hydroxylase Complementary Dna (Cdna), supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/1.6-kb polymerase chain reaction–synthesized fragment of rat cholesterol 7a-hydroxylase complementary dna (cdna)/product/Boehringer Mannheim Average 90 stars, based on 1 article reviews
1.6-kb polymerase chain reaction–synthesized fragment of rat cholesterol 7a-hydroxylase complementary dna (cdna) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |