custom synthesized dna fragments Search Results


designed dna fragments  (GenScript corporation)
90
GenScript corporation designed dna fragments
Designed Dna Fragments, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+synthesized+dna+fragments/custom+dna+fragments/pm31217586-408-1-7
Average 90 stars, based on 1 article reviews
designed dna fragments - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
synthesized dna fragment containing a hepatitis d virus ribozyme (hdvr) sequence  (GenScript corporation)
90
GenScript corporation synthesized dna fragment containing a hepatitis d virus ribozyme (hdvr) sequence
Synthesized Dna Fragment Containing A Hepatitis D Virus Ribozyme (Hdvr) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+synthesized+dna+fragments/synthesized+dna+fragment+containing+a+hepatitis+d+virus+ribozyme++hdvr++sequence/pmc09778660-136-3-18
Average 90 stars, based on 1 article reviews
synthesized dna fragment containing a hepatitis d virus ribozyme (hdvr) sequence - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
synthesized dna fragment comprising the comt2 gene  (GenScript corporation)
90
GenScript corporation synthesized dna fragment comprising the comt2 gene
Synthesized Dna Fragment Comprising The Comt2 Gene, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+synthesized+dna+fragments/synthesized+dna+fragment+comprising+the+comt2+gene/us10858676-1566-6-13
Average 90 stars, based on 1 article reviews
synthesized dna fragment comprising the comt2 gene - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
custom bead purification protocol spri size selection protocol for >1.5-2 kb dna fragments  (Oxford Nanopore)
90
Oxford Nanopore custom bead purification protocol spri size selection protocol for >1.5-2 kb dna fragments
Each line plot represents the read size distribution from each mock community species estimated from <t>the</t> <t>Nanopore</t> metagenome data. A) is data generated from a ZymoBIOMICS Microbial Community Standard (even) [D6300, batch ZRC190633] by the Loman lab using the Nanopore GridION and a R9.4.1 flowcell. B) is in-house data generated from a ZymoBIOMICS Microbial Community <t>DNA</t> Standard (even) [product D6306, batch ZRC190811] using Nanopore MinION and a R10 flowcell. Some species have significantly more high molecular weight DNA over 5000 bp compared to some of the other species, which impacts the effective template availability in PCR for long amplicons. For the Loman lab data, the distinct gram+/- dependent trends fragment length is anticipated from their two step extraction protocol used on the mock community. The in-house generated data is generated from DNA standard prepared by the vendor, and here the taxa trend is not as pronounced, but the effect on the effective relative abundance is still dramatic . We can only speculate about the cause, but different extraction methods could be the reason. If all samples had been extracted with the same method, the result should be more similar fragment distributions as indicated by the Loman group data. The Nanopore library preparation and sequencing likely had an impact on the observed read fragment distributions, but the Loman group data indicates that extraction method probably is the most important factor.
Custom Bead Purification Protocol Spri Size Selection Protocol For >1.5 2 Kb Dna Fragments, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+synthesized+dna+fragments/custom+bead+purification+protocol+spri+size+selection+protocol+for++1+5+2+kb+dna+fragments/bio_rxiv__645903-82-17-20
Average 90 stars, based on 1 article reviews
custom bead purification protocol spri size selection protocol for >1.5-2 kb dna fragments - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
chemically synthesized dna fragment for ptc promoter region (−758 to +130)  (GenScript corporation)
90
GenScript corporation chemically synthesized dna fragment for ptc promoter region (−758 to +130)
Each line plot represents the read size distribution from each mock community species estimated from <t>the</t> <t>Nanopore</t> metagenome data. A) is data generated from a ZymoBIOMICS Microbial Community Standard (even) [D6300, batch ZRC190633] by the Loman lab using the Nanopore GridION and a R9.4.1 flowcell. B) is in-house data generated from a ZymoBIOMICS Microbial Community <t>DNA</t> Standard (even) [product D6306, batch ZRC190811] using Nanopore MinION and a R10 flowcell. Some species have significantly more high molecular weight DNA over 5000 bp compared to some of the other species, which impacts the effective template availability in PCR for long amplicons. For the Loman lab data, the distinct gram+/- dependent trends fragment length is anticipated from their two step extraction protocol used on the mock community. The in-house generated data is generated from DNA standard prepared by the vendor, and here the taxa trend is not as pronounced, but the effect on the effective relative abundance is still dramatic . We can only speculate about the cause, but different extraction methods could be the reason. If all samples had been extracted with the same method, the result should be more similar fragment distributions as indicated by the Loman group data. The Nanopore library preparation and sequencing likely had an impact on the observed read fragment distributions, but the Loman group data indicates that extraction method probably is the most important factor.
Chemically Synthesized Dna Fragment For Ptc Promoter Region (−758 To +130), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+synthesized+dna+fragments/chemically+synthesized+dna+fragment+for+ptc+promoter+region+++758+to++130+/pmc11721587-350-1-13
Average 90 stars, based on 1 article reviews
chemically synthesized dna fragment for ptc promoter region (−758 to +130) - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
synthesized dna fragment 5’-cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag-3  (Metabion International AG)
90
Metabion International AG synthesized dna fragment 5’-cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag-3
Each line plot represents the read size distribution from each mock community species estimated from <t>the</t> <t>Nanopore</t> metagenome data. A) is data generated from a ZymoBIOMICS Microbial Community Standard (even) [D6300, batch ZRC190633] by the Loman lab using the Nanopore GridION and a R9.4.1 flowcell. B) is in-house data generated from a ZymoBIOMICS Microbial Community <t>DNA</t> Standard (even) [product D6306, batch ZRC190811] using Nanopore MinION and a R10 flowcell. Some species have significantly more high molecular weight DNA over 5000 bp compared to some of the other species, which impacts the effective template availability in PCR for long amplicons. For the Loman lab data, the distinct gram+/- dependent trends fragment length is anticipated from their two step extraction protocol used on the mock community. The in-house generated data is generated from DNA standard prepared by the vendor, and here the taxa trend is not as pronounced, but the effect on the effective relative abundance is still dramatic . We can only speculate about the cause, but different extraction methods could be the reason. If all samples had been extracted with the same method, the result should be more similar fragment distributions as indicated by the Loman group data. The Nanopore library preparation and sequencing likely had an impact on the observed read fragment distributions, but the Loman group data indicates that extraction method probably is the most important factor.
Synthesized Dna Fragment 5’ Cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag 3, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+synthesized+dna+fragments/synthesized+dna+fragment+5%E2%80%99+cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag+3/pmc03788786-62-16-19
Average 90 stars, based on 1 article reviews
synthesized dna fragment 5’-cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag-3 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
swai-aflii synthesized dna fragments  (GenScript corporation)
90
GenScript corporation swai-aflii synthesized dna fragments
Each line plot represents the read size distribution from each mock community species estimated from <t>the</t> <t>Nanopore</t> metagenome data. A) is data generated from a ZymoBIOMICS Microbial Community Standard (even) [D6300, batch ZRC190633] by the Loman lab using the Nanopore GridION and a R9.4.1 flowcell. B) is in-house data generated from a ZymoBIOMICS Microbial Community <t>DNA</t> Standard (even) [product D6306, batch ZRC190811] using Nanopore MinION and a R10 flowcell. Some species have significantly more high molecular weight DNA over 5000 bp compared to some of the other species, which impacts the effective template availability in PCR for long amplicons. For the Loman lab data, the distinct gram+/- dependent trends fragment length is anticipated from their two step extraction protocol used on the mock community. The in-house generated data is generated from DNA standard prepared by the vendor, and here the taxa trend is not as pronounced, but the effect on the effective relative abundance is still dramatic . We can only speculate about the cause, but different extraction methods could be the reason. If all samples had been extracted with the same method, the result should be more similar fragment distributions as indicated by the Loman group data. The Nanopore library preparation and sequencing likely had an impact on the observed read fragment distributions, but the Loman group data indicates that extraction method probably is the most important factor.
Swai Aflii Synthesized Dna Fragments, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+synthesized+dna+fragments/swai+aflii+synthesized+dna+fragments/pmc04272407-161-16-20
Average 90 stars, based on 1 article reviews
swai-aflii synthesized dna fragments - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
custom synthesized dna oligomers (primers) with codon usage optimized for e. coli  (BioTeZ Inc)
90
BioTeZ Inc custom synthesized dna oligomers (primers) with codon usage optimized for e. coli
Each line plot represents the read size distribution from each mock community species estimated from <t>the</t> <t>Nanopore</t> metagenome data. A) is data generated from a ZymoBIOMICS Microbial Community Standard (even) [D6300, batch ZRC190633] by the Loman lab using the Nanopore GridION and a R9.4.1 flowcell. B) is in-house data generated from a ZymoBIOMICS Microbial Community <t>DNA</t> Standard (even) [product D6306, batch ZRC190811] using Nanopore MinION and a R10 flowcell. Some species have significantly more high molecular weight DNA over 5000 bp compared to some of the other species, which impacts the effective template availability in PCR for long amplicons. For the Loman lab data, the distinct gram+/- dependent trends fragment length is anticipated from their two step extraction protocol used on the mock community. The in-house generated data is generated from DNA standard prepared by the vendor, and here the taxa trend is not as pronounced, but the effect on the effective relative abundance is still dramatic . We can only speculate about the cause, but different extraction methods could be the reason. If all samples had been extracted with the same method, the result should be more similar fragment distributions as indicated by the Loman group data. The Nanopore library preparation and sequencing likely had an impact on the observed read fragment distributions, but the Loman group data indicates that extraction method probably is the most important factor.
Custom Synthesized Dna Oligomers (Primers) With Codon Usage Optimized For E. Coli, supplied by BioTeZ Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+synthesized+dna+fragments/custom+synthesized+dna+oligomers/pm18035040-73-6-15
Average 90 stars, based on 1 article reviews
custom synthesized dna oligomers (primers) with codon usage optimized for e. coli - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
custom-synthesized oligo-dna probes npy  (Microsynth ag)
90
Microsynth ag custom-synthesized oligo-dna probes npy
Each line plot represents the read size distribution from each mock community species estimated from <t>the</t> <t>Nanopore</t> metagenome data. A) is data generated from a ZymoBIOMICS Microbial Community Standard (even) [D6300, batch ZRC190633] by the Loman lab using the Nanopore GridION and a R9.4.1 flowcell. B) is in-house data generated from a ZymoBIOMICS Microbial Community <t>DNA</t> Standard (even) [product D6306, batch ZRC190811] using Nanopore MinION and a R10 flowcell. Some species have significantly more high molecular weight DNA over 5000 bp compared to some of the other species, which impacts the effective template availability in PCR for long amplicons. For the Loman lab data, the distinct gram+/- dependent trends fragment length is anticipated from their two step extraction protocol used on the mock community. The in-house generated data is generated from DNA standard prepared by the vendor, and here the taxa trend is not as pronounced, but the effect on the effective relative abundance is still dramatic . We can only speculate about the cause, but different extraction methods could be the reason. If all samples had been extracted with the same method, the result should be more similar fragment distributions as indicated by the Loman group data. The Nanopore library preparation and sequencing likely had an impact on the observed read fragment distributions, but the Loman group data indicates that extraction method probably is the most important factor.
Custom Synthesized Oligo Dna Probes Npy, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+synthesized+dna+fragments/custom+synthesized+oligo+dna+probes+npy/pmc03399768-87-6-8
Average 90 stars, based on 1 article reviews
custom-synthesized oligo-dna probes npy - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
synthesized dna fragment corresponding to cfr  (GenScript corporation)
90
GenScript corporation synthesized dna fragment corresponding to cfr
Each line plot represents the read size distribution from each mock community species estimated from <t>the</t> <t>Nanopore</t> metagenome data. A) is data generated from a ZymoBIOMICS Microbial Community Standard (even) [D6300, batch ZRC190633] by the Loman lab using the Nanopore GridION and a R9.4.1 flowcell. B) is in-house data generated from a ZymoBIOMICS Microbial Community <t>DNA</t> Standard (even) [product D6306, batch ZRC190811] using Nanopore MinION and a R10 flowcell. Some species have significantly more high molecular weight DNA over 5000 bp compared to some of the other species, which impacts the effective template availability in PCR for long amplicons. For the Loman lab data, the distinct gram+/- dependent trends fragment length is anticipated from their two step extraction protocol used on the mock community. The in-house generated data is generated from DNA standard prepared by the vendor, and here the taxa trend is not as pronounced, but the effect on the effective relative abundance is still dramatic . We can only speculate about the cause, but different extraction methods could be the reason. If all samples had been extracted with the same method, the result should be more similar fragment distributions as indicated by the Loman group data. The Nanopore library preparation and sequencing likely had an impact on the observed read fragment distributions, but the Loman group data indicates that extraction method probably is the most important factor.
Synthesized Dna Fragment Corresponding To Cfr, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+synthesized+dna+fragments/synthesized+dna+fragment+corresponding+to+cfr/pmc04807367-126-22-23
Average 90 stars, based on 1 article reviews
synthesized dna fragment corresponding to cfr - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
dna fragment  (MWG-Biotech ag)
90
MWG-Biotech ag dna fragment
Each line plot represents the read size distribution from each mock community species estimated from <t>the</t> <t>Nanopore</t> metagenome data. A) is data generated from a ZymoBIOMICS Microbial Community Standard (even) [D6300, batch ZRC190633] by the Loman lab using the Nanopore GridION and a R9.4.1 flowcell. B) is in-house data generated from a ZymoBIOMICS Microbial Community <t>DNA</t> Standard (even) [product D6306, batch ZRC190811] using Nanopore MinION and a R10 flowcell. Some species have significantly more high molecular weight DNA over 5000 bp compared to some of the other species, which impacts the effective template availability in PCR for long amplicons. For the Loman lab data, the distinct gram+/- dependent trends fragment length is anticipated from their two step extraction protocol used on the mock community. The in-house generated data is generated from DNA standard prepared by the vendor, and here the taxa trend is not as pronounced, but the effect on the effective relative abundance is still dramatic . We can only speculate about the cause, but different extraction methods could be the reason. If all samples had been extracted with the same method, the result should be more similar fragment distributions as indicated by the Loman group data. The Nanopore library preparation and sequencing likely had an impact on the observed read fragment distributions, but the Loman group data indicates that extraction method probably is the most important factor.
Dna Fragment, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+synthesized+dna+fragments/artificial+synthesized+dna+fragment/10__1128_slash_aem__00735___11-92-10-12
Average 90 stars, based on 1 article reviews
dna fragment - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
dna fragment coding for ispe of p. falciparum  (GenScript corporation)
90
GenScript corporation dna fragment coding for ispe of p. falciparum
Each line plot represents the read size distribution from each mock community species estimated from <t>the</t> <t>Nanopore</t> metagenome data. A) is data generated from a ZymoBIOMICS Microbial Community Standard (even) [D6300, batch ZRC190633] by the Loman lab using the Nanopore GridION and a R9.4.1 flowcell. B) is in-house data generated from a ZymoBIOMICS Microbial Community <t>DNA</t> Standard (even) [product D6306, batch ZRC190811] using Nanopore MinION and a R10 flowcell. Some species have significantly more high molecular weight DNA over 5000 bp compared to some of the other species, which impacts the effective template availability in PCR for long amplicons. For the Loman lab data, the distinct gram+/- dependent trends fragment length is anticipated from their two step extraction protocol used on the mock community. The in-house generated data is generated from DNA standard prepared by the vendor, and here the taxa trend is not as pronounced, but the effect on the effective relative abundance is still dramatic . We can only speculate about the cause, but different extraction methods could be the reason. If all samples had been extracted with the same method, the result should be more similar fragment distributions as indicated by the Loman group data. The Nanopore library preparation and sequencing likely had an impact on the observed read fragment distributions, but the Loman group data indicates that extraction method probably is the most important factor.
Dna Fragment Coding For Ispe Of P. Falciparum, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+synthesized+dna+fragments/custom+synthesised+dna+fragment+coding+for+ispe+of+p++falciparum/pmc08128065-206-6-13
Average 90 stars, based on 1 article reviews
dna fragment coding for ispe of p. falciparum - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


Each line plot represents the read size distribution from each mock community species estimated from the Nanopore metagenome data. A) is data generated from a ZymoBIOMICS Microbial Community Standard (even) [D6300, batch ZRC190633] by the Loman lab using the Nanopore GridION and a R9.4.1 flowcell. B) is in-house data generated from a ZymoBIOMICS Microbial Community DNA Standard (even) [product D6306, batch ZRC190811] using Nanopore MinION and a R10 flowcell. Some species have significantly more high molecular weight DNA over 5000 bp compared to some of the other species, which impacts the effective template availability in PCR for long amplicons. For the Loman lab data, the distinct gram+/- dependent trends fragment length is anticipated from their two step extraction protocol used on the mock community. The in-house generated data is generated from DNA standard prepared by the vendor, and here the taxa trend is not as pronounced, but the effect on the effective relative abundance is still dramatic . We can only speculate about the cause, but different extraction methods could be the reason. If all samples had been extracted with the same method, the result should be more similar fragment distributions as indicated by the Loman group data. The Nanopore library preparation and sequencing likely had an impact on the observed read fragment distributions, but the Loman group data indicates that extraction method probably is the most important factor.

Journal: bioRxiv

Article Title: Enabling high-accuracy long-read amplicon sequences using unique molecular identifiers with Nanopore or PacBio sequencing

doi: 10.1101/645903

Figure Lengend Snippet: Each line plot represents the read size distribution from each mock community species estimated from the Nanopore metagenome data. A) is data generated from a ZymoBIOMICS Microbial Community Standard (even) [D6300, batch ZRC190633] by the Loman lab using the Nanopore GridION and a R9.4.1 flowcell. B) is in-house data generated from a ZymoBIOMICS Microbial Community DNA Standard (even) [product D6306, batch ZRC190811] using Nanopore MinION and a R10 flowcell. Some species have significantly more high molecular weight DNA over 5000 bp compared to some of the other species, which impacts the effective template availability in PCR for long amplicons. For the Loman lab data, the distinct gram+/- dependent trends fragment length is anticipated from their two step extraction protocol used on the mock community. The in-house generated data is generated from DNA standard prepared by the vendor, and here the taxa trend is not as pronounced, but the effect on the effective relative abundance is still dramatic . We can only speculate about the cause, but different extraction methods could be the reason. If all samples had been extracted with the same method, the result should be more similar fragment distributions as indicated by the Loman group data. The Nanopore library preparation and sequencing likely had an impact on the observed read fragment distributions, but the Loman group data indicates that extraction method probably is the most important factor.

Article Snippet: The PCR product was purified using a custom bead purification protocol “SPRI size selection protocol for >1.5-2 kb DNA fragments” (Oxford Nanopore, England) based on: dx.doi.org/10.17504/protocols.io.idmca46.

Techniques: Generated, High Molecular Weight, Extraction, Sequencing

Read coverage profiles of the ZymoBIOMICS Microbial Community DNA Standard based on shotgun Nanopore sequencing data. Each grey point is the average coverage value of a 10 kbp region within the genome. Colored points represents the position of the individual intragenomic rRNA operons. A) is data generated from a ZymoBIOMICS Microbial Community Standard (even) [product D6300, batch ZRC190633] by the Loman lab using the Nanopore GridION and a R9.4.1 flowcell. B) is our data generated from a ZymoBIOMICS Microbial Community DNA Standard (even) [product D6306, batch ZRC190811] using Nanopore MinION and a R10 flowcell.

Journal: bioRxiv

Article Title: Enabling high-accuracy long-read amplicon sequences using unique molecular identifiers with Nanopore or PacBio sequencing

doi: 10.1101/645903

Figure Lengend Snippet: Read coverage profiles of the ZymoBIOMICS Microbial Community DNA Standard based on shotgun Nanopore sequencing data. Each grey point is the average coverage value of a 10 kbp region within the genome. Colored points represents the position of the individual intragenomic rRNA operons. A) is data generated from a ZymoBIOMICS Microbial Community Standard (even) [product D6300, batch ZRC190633] by the Loman lab using the Nanopore GridION and a R9.4.1 flowcell. B) is our data generated from a ZymoBIOMICS Microbial Community DNA Standard (even) [product D6306, batch ZRC190811] using Nanopore MinION and a R10 flowcell.

Article Snippet: The PCR product was purified using a custom bead purification protocol “SPRI size selection protocol for >1.5-2 kb DNA fragments” (Oxford Nanopore, England) based on: dx.doi.org/10.17504/protocols.io.idmca46.

Techniques: Nanopore Sequencing, Generated